Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07314

HP ID(1) HP07314
Gene ID(2) 6996
Gene Symbol finder TDG
Protein Name thymine-DNA glycosylase?
RefSeq NM_003211.4
Length of RefSeq (bp) 3251
Chromosome 12q24.1
Reference DDBJ accession
UniGene Hs.584809

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi47D10 pGCAP10 GGTTGGGGTTGTCTTACCGCAGTGAGTACCACGCGGTACTACAGAGACCGGCTGCCCGTG
ARiS013H10 pGCAP10 GCCAGGTCTCTGGGGTTGTCTTACCGCAGTGAGTACCACGCGGTACTACAGAGACCGGCT
RBd27H06 pGCAP10 GGAGTCCAGCCACTGTCTGGGTACTGCCAGCCATCGGGCCCAGGTCTCTGGGGTTGTCTT
RBdS187C16 pGCAP10 GGGAGGAGCTTGAGTCCAGCCACTGTCTGGGTACTGCCAGCCATCGGGCCCAGGTCTCTG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl