Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07300

HP ID(1) HP07300
Gene ID(2) 26015
Gene Symbol finder RPAP1
Protein Name RNA polymerase II associated protein 1
RefSeq NM_015540.2
Length of RefSeq (bp) 4698
Chromosome 15q15.1
Reference DDBJ accession
UniGene Hs.371045

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS013A18 pGCAP10 CGGCCGGCCGATGGCGGGGCAAGATGGCGGCGCCCAGACAGGCCTGGAGCACGGATGAAT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl