Prev. |  KEGG KO K20826 > 

RIKEN DNA Bank Human Resource - RPAP1

Gene ID NCBI Gene 26015 |  KEGG hsa:26015
Gene Symbol RPAP1
Protein Name RNA polymerase II associated protein 1
Synonyms -
Ortholog resource in our bank

  RPAP1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY082416 IRAL006A16 pOTB7 BC000246 NM_015540 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE097218 M01C043A18 pDONR221 MGC11-B09 BC000246 NM_015540  
HGE097266 M01C043C18 pDONR221 MGC11-B09 BC000246 NM_015540  
HGE097314 M01C043E18 pDONR221 MGC11-B09 BC000246 NM_015540  
HGE097362 M01C043G18 pDONR221 MGC11-B09 BC000246 NM_015540  
HGE097410 M01C043I18 pDONR221 MGC11-B09 BC000246 NM_015540  
HGE097458 M01C043K18 pDONR221 MGC11-B09 BC000246 NM_015540  
HGE097506 M01C043M18 pDONR221 MGC11-B09 BC000246 NM_015540  
HGE097554 M01C043O18 pDONR221 MGC11-B09 BC000246 NM_015540  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR205218 ARiS013A18 pGCAP10 NM_015540.2  
CGGCCGGCCGATGGCGGGGCAAGATGGCGGCGCCCAGACAGGCCTGGAGCACGGATGAAT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl