Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07285

HP ID(1) HP07285
Gene ID(2) 8045
Gene Symbol finder RASSF7
Protein Name Ras association (RalGDS/AF-6) domain family 7
RefSeq NM_003475.3
Length of RefSeq (bp) 1554
Chromosome 11p15.5
Reference DDBJ accession
UniGene Hs.72925

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi44H08 pGCAP10 GGGCGGCGCCGGAGCGGGTCTCCAGGCTGGCGAGCGCCCAGGACAGGCATGTTGTTGGGA
ARiS008K02 pGCAP10 GGCGGCGCTGGGGGCGGCAGGTTGCGGCGGCGCCGGAGCGGGTCTCCAGGCTGGCGAGCG
ARiS096M14 pGCAP10 GAGGCTGGCGAGCGCCCAGGACAGGCATGTTGTTGGGACTGGCGGCCATGGAGCTGAAGG
RBd64F06 pGCAP10 GGCGGCGCTGGGGGCGGCAGGTTGCGGCGGCGCCGGAGCGGGTCTCCAGGCTGGCGAGCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl