Prev. |  KEGG KO K09855 > 

RIKEN DNA Bank Human Resource - RASSF7

Gene ID NCBI Gene 8045 |  KEGG hsa:8045
Gene Symbol RASSF7
Protein Name Ras association domain family member 7
Synonyms C11orf13|HRAS1|HRC1
Ortholog resources KEGG ortholog (KEGG orthology K09855) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR177776 ARi44H08 pGCAP10 NM_003475.3  
GGGCGGCGCCGGAGCGGGTCTCCAGGCTGGCGAGCGCCCAGGACAGGCATGTTGTTGGGA
HKR203442 ARiS008K02 pGCAP10 NM_003475.3  
GGCGGCGCTGGGGGCGGCAGGTTGCGGCGGCGCCGGAGCGGGTCTCCAGGCTGGCGAGCG
HKR238702 ARiS096M14 pGCAP10 NM_003475.3  
GAGGCTGGCGAGCGCCCAGGACAGGCATGTTGTTGGGACTGGCGGCCATGGAGCTGAAGG
HKR385726 RBd64F06 pGCAP10 NM_003475.3  
GGCGGCGCTGGGGGCGGCAGGTTGCGGCGGCGCCGGAGCGGGTCTCCAGGCTGGCGAGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl