Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07270

HP ID(1) HP07270
Gene ID(2) 80223
Gene Symbol finder RAB11FIP1
Protein Name RAB11 family interacting protein 1 (class I)?
RefSeq NM_025151.3
Length of RefSeq (bp) 4222
Chromosome 8p11.22
Reference DDBJ accession
UniGene Hs.696035

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS008B11 pGCAP10 GGTGGAGGCCGCCAGTCGCGGCGATCTTCTCCTCGCTTCTGGAGTGTTATCGTCACCATG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl