Prev. |  KEGG KO K12484 > 

RIKEN DNA Bank Human Resource - RAB11FIP1

Gene ID NCBI Gene 80223 |  KEGG hsa:80223
Gene Symbol RAB11FIP1
Protein Name RAB11 family interacting protein 1
Synonyms NOEL1A|RCP|rab11-FIP1
Featured content Endocytosis (human)
Ortholog resource in our bank

  RAB11FIP1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001631 IRAK004B07 pCMV-SPORT6 BC001314 NM_025151 Partial/var
HGY101950 IRAL054O14 pOTB7 BC077720 NM_025151 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR203235 ARiS008B11 pGCAP10 NM_025151.3  
GGTGGAGGCCGCCAGTCGCGGCGATCTTCTCCTCGCTTCTGGAGTGTTATCGTCACCATG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl