Prev. | NRCD Clone J | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07259

HP ID(1) HP07259
Gene ID(2) 3718
Gene Symbol finder JAK3
Protein Name Janus kinase 3 (a protein tyrosine kinase, leukocyte)
RefSeq NM_000215.3
Length of RefSeq (bp) 5449
Chromosome 19p13.1
Reference DDBJ accession
UniGene Hs.515247

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd14A03 pGCAP10 GGAGGAGTGGGTGGGTGGGCGCTGGAACGAGGCAAGACTAAGAGGCAGAGTCCTCCAGCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl