RIKEN DNA Bank Human Resource

RIKEN DNA Bank Human Resource - JAK3

Gene ID	NCBI Gene 3718 \| KEGG hsa:3718
Gene Symbol	JAK3
Protein Name	Janus kinase 3
Synonyms	JAK-3\|JAK3_HUMAN\|JAKL\|L-JAK\|LJAK
Featured content	Signaling pathways regulating pluripotency of stem cells (human)
Featured content	Jak-STAT signaling pathway (human)
Featured content	Kinases Included in Myristoylated Kinase Library (human) in Boehm JS Cell 129 (6):1065-1079 (2007). PMID: 17574021.

Ortholog resource in our bank

  JAK3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	CDS comparison
	Clone name	Vector	Refered mRNA⁽¹⁾	CDS status
	5'-terminal sequence⁽²⁾
HKR365603	RBd14A03	pGCAP10	NM_000215.3	VA
HKR365603	GGAGGAGTGGGTGGGTGGGCGCTGGAACGAGGCAAGACTAAGAGGCAGAGTCCTCCAGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl