Prev. |  KEGG KO K11218 > 

RIKEN DNA Bank Human Resource - JAK3

Gene ID NCBI Gene 3718 |  KEGG hsa:3718
Gene Symbol JAK3
Protein Name Janus kinase 3
Synonyms JAK-3|JAK3_HUMAN|JAKL|L-JAK|LJAK
Featured content Signaling pathways regulating pluripotency of stem cells (human)
Featured content Jak-STAT signaling pathway (human)
Featured content Kinases Included in Myristoylated Kinase Library (human) in Boehm JS Cell 129 (6):1065-1079 (2007). PMID: 17574021.
Ortholog resource in our bank

  JAK3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR365603 RBd14A03 pGCAP10 NM_000215.3 VA done
GGAGGAGTGGGTGGGTGGGCGCTGGAACGAGGCAAGACTAAGAGGCAGAGTCCTCCAGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl