Prev. |  Human A to Z list >  J >  JAK3 > 

NRCD Human cDNA Clone - RBd14A03

Ordering information ordering information
Catalog Number HKR365603
Clone Name RBd14A03
Vector plasmidClick for information pGCAP10
5'-terminal sequence(1) GGAGGAGTGGGTGGGTGGGCGCTGGAACGAGGCAAGACTAAGAGGCAGAGTCCTCCAGCC
Sequence, submitted(2) Not available.
Description Plasmid clone of human JAK3 cDNA with SV40 promoter
 
HP ID HP07259  finder other clones in this HP group.
Sequence, refered (NCBI RefSeq mRNA) NM_000215.3
Gene ID 3718
Gene Symbol JAK3  finder other clones with this gene.
Synonyms JAK-3|JAK3_HUMAN|JAKL|L-JAK|LJAK
Protein Name Janus kinase 3
KEGG link 01
Links

  NCBI Gene

  NCBI RefSeq

Full length sequence and restriction map are not available.

This clone has been sequenced a portion and digested by restriction enzyme for verification. Results are available. please download the data . Click below!

Seq File
(by primer A)
Seq File
(by primer B)
Seq File
(by primer C)
Seq File
(contig)
PDF File
RBd14A03a.seq   RBd14A03c.seq   RBd14A03.pdf

(1) 5' terminal sequence of insert provided by the depositor.

(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ).


2015.07.16

J:\Perl_src_\csv_set\NRCDhumcloneList_RB_140122.csv - GNP_filter3_NRCD_html_150711.pl