Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07246

HP ID(1) HP07246
Gene ID(2) 283643
Gene Symbol finder C14orf80
Protein Name chromosome 14 open reading frame 80
RefSeq NM_173608.2
Length of RefSeq (bp) 1563
Chromosome 14q32.33
Reference DDBJ accession
UniGene Hs.70327

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd21F11 pGCAP10 GGCAGGTCCCAGCCGCCGCACTAAACCCGGCCCGTGCGGTGATTGGACGCAGGCCCCGGG
RBdS081B03 pGCAP10 GAGGCGGGCGATCCGAAAGAGGCTGGTGCTGGCTGCATGGGGAGGCGGCGGCAGCGGGTG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl