Prev. | 

RIKEN DNA Bank Human Resource - TEDC1

Gene ID NCBI Gene 283643 |  KEGG hsa:283643
Gene Symbol TEDC1
Protein Name tubulin epsilon and delta complex 1
Synonyms C14orf80
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX006029 IRAK015B05 pCMV-SPORT6 BC016028 NM_173608

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE092014 M01C030A14 pDONR221 MGC04-F07 BC016028 NM_173608  
HGE092062 M01C030C14 pDONR221 MGC04-F07 BC016028 NM_173608  
HGE092110 M01C030E14 pDONR221 MGC04-F07 BC016028 NM_173608  
HGE092158 M01C030G14 pDONR221 MGC04-F07 BC016028 NM_173608  
HGE092206 M01C030I14 pDONR221 MGC04-F07 BC016028 NM_173608  
HGE092254 M01C030K14 pDONR221 MGC04-F07 BC016028 NM_173608  
HGE092302 M01C030M14 pDONR221 MGC04-F07 BC016028 NM_173608  
HGE092350 M01C030O14 pDONR221 MGC04-F07 BC016028 NM_173608  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR368531 RBd21F11 pGCAP10 NM_173608.2  
GGCAGGTCCCAGCCGCCGCACTAAACCCGGCCCGTGCGGTGATTGGACGCAGGCCCCGGG
HKR432427 RBdS081B03 pGCAP10 NM_173608.2  
GAGGCGGGCGATCCGAAAGAGGCTGGTGCTGGCTGCATGGGGAGGCGGCGGCAGCGGGTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl