Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS081B03

Clone ID RBdS081B03
HP ID HP07246
Gene ID 283643
Gene Symbol C14orf80
Protein Name chromosome 14 open reading frame 80
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_173608.2
Length of RefSeq (bp) 1563
Chromosome 14q32.33
Reference DDBJ accession
UniGene Hs.70327
5'-terminal sequence GAGGCGGGCGATCCGAAAGAGGCTGGTGCTGGCTGCATGGGGAGGCGGCGGCAGCGGGTG
2011.08.28