Prev. | NRCD Clone U | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07165

HP ID(1) HP07165
Gene ID(2) 51096
Gene Symbol finder UTP18
Protein Name UTP18, small subunit (SSU) processome component, homolog (yeast)
RefSeq NM_016001.2
Length of RefSeq (bp) 1893
Chromosome 17q21.33
Reference DDBJ accession
UniGene Hs.709327

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi49A11 pGCAP10 GGTGAGCGCCTGCCTTTCTCCTCTGACCTANCCATGCCGCTNGAGCGGATGAGACNAATG
ARi49B12 pGCAP10 GGTGAGCGCCTGCGTTTCTCCTCAAACCTAACGATGCCGCCGGAGCGGAGGAGACGAATG
RBd11C04 pGCAP10 AGGAGGTTCCACGTGAGCGCCTGCGTTTCTCCTCAAACCTAACGATGCCGCCGGAGCGGA
RBd39C07 pGCAP10 GGGCGGCGGCGGCCCGCGAGGGGCCTGGGCGCATGCGCAGCGAGGTTCCACGTGAGCGCC
RBd64D04 pGCAP10 GGGGCGCATGCGCAGCGAGGTTCCACGTGAGCGCCTGCGTTTCTCCTCAAACCTAACGAT
RBd80E07 pGCAP10 GCCACGTGAGCGCCTGCGTTTCTCCTCAAACCTAACGATGCCGCCGGAGCGGAGGAGACG
RBdS083M22 pGCAP10 GGCGCAGCGAGGTTCCACGTGAGCGCCTGCGTTTCTCCTCAAACCTAACGATGCCGCCGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl