Prev. |  KEGG KO K14553 > 

RIKEN DNA Bank Human Resource - UTP18

Gene ID NCBI Gene 51096 |  KEGG hsa:51096
Gene Symbol UTP18
Protein Name UTP18, small subunit processome component
Synonyms CGI-48|WDR50
Ortholog resources KEGG ortholog (KEGG orthology K14553) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY096988 IRAL042H20 pOTB7 BC025276 NM_016001 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR179611 ARi49A11 pGCAP10 NM_016001.2  
GGTGAGCGCCTGCCTTTCTCCTCTGACCTANCCATGCCGCTNGAGCGGATGAGACNAATG
HKR179636 ARi49B12 pGCAP10 NM_016001.2  
GGTGAGCGCCTGCGTTTCTCCTCAAACCTAACGATGCCGCCGGAGCGGAGGAGACGAATG
HKR364452 RBd11C04 pGCAP10 NM_016001.2  
AGGAGGTTCCACGTGAGCGCCTGCGTTTCTCCTCAAACCTAACGATGCCGCCGGAGCGGA
HKR375655 RBd39C07 pGCAP10 NM_016001.2  
GGGCGGCGGCGGCCCGCGAGGGGCCTGGGCGCATGCGCAGCGAGGTTCCACGTGAGCGCC
HKR385676 RBd64D04 pGCAP10 NM_016001.2  
GGGGCGCATGCGCAGCGAGGTTCCACGTGAGCGCCTGCGTTTCTCCTCAAACCTAACGAT
HKR392103 RBd80E07 pGCAP10 NM_016001.2  
GCCACGTGAGCGCCTGCGTTTCTCCTCAAACCTAACGATGCCGCCGGAGCGGAGGAGACG
HKR433510 RBdS083M22 pGCAP10 NM_016001.2  
GGCGCAGCGAGGTTCCACGTGAGCGCCTGCGTTTCTCCTCAAACCTAACGATGCCGCCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl