Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS083M22

Clone ID RBdS083M22
HP ID HP07165
Gene ID 51096
Gene Symbol UTP18
Protein Name UTP18, small subunit (SSU) processome component, homolog (yeast)
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_016001.2
Length of RefSeq (bp) 1893
Chromosome 17q21.33
Reference DDBJ accession
UniGene Hs.709327
5'-terminal sequence GGCGCAGCGAGGTTCCACGTGAGCGCCTGCGTTTCTCCTCAAACCTAACGATGCCGCCGG
2011.08.28