Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06999

HP ID(1) HP06999
Gene ID(2) 643155
Gene Symbol finder C5orf43
Protein Name chromosome 5 open reading frame 43
RefSeq NM_001048249.3
Length of RefSeq (bp) 2895
Chromosome 5q12.1
Reference DDBJ accession
UniGene Hs.508479

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi75A02 pGCAP10 GGGATCCGATCCCGTGGGGCTATGTAGGGGAAGTTGGTGGCTGCAGCTGCCGTGGTTTTC
RBdS013P19 pGCAP10 GTTCCGGTCTGGCGGTGAGTGGGGAGTGGGATCCGATCCCGTGGGGCTATGTAGGGGAAG
RBdS083B05 pGCAP10 GGTAGGGGAAGTTGGTGGCTGCAGCTGCCGTGGTTTTCTCCTGGTGTCCAGCAGAAACGG
RBdS105E24 pGCAP10 CGGCCGGCCGATGGGGGAGTGGGATCCGATCCCGTGGGGCTATGTAGGGGAAGTTGGTGG
RBdS156K08 pGCAP10 GCTTCCTGCTTCCGGTCTGGCGGTGAGTGGGGAGTGGGATCCGATCCCGTGGGGCTATGT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl