Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS105E24

Clone ID RBdS105E24
HP ID HP06999
Gene ID 643155
Gene Symbol C5orf43
Protein Name chromosome 5 open reading frame 43
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_001048249.3
Length of RefSeq (bp) 2895
Chromosome 5q12.1
Reference DDBJ accession
UniGene Hs.508479
5'-terminal sequence CGGCCGGCCGATGGGGGAGTGGGATCCGATCCCGTGGGGCTATGTAGGGGAAGTTGGTGG
2011.08.28