Prev. | 

RIKEN DNA Bank Human Resource - SMIM15

Gene ID NCBI Gene 643155 |  KEGG hsa:643155
Gene Symbol SMIM15
Protein Name small integral membrane protein 15
Synonyms C5orf43
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY036461 IRAK091C13 pBluescript BC047489 XM_938936 Full
HGX055885 IRAK139L21 pCMV-SPORT6 BC066550 XM_938936 Full
HGY092270 IRAL030L06 pOTB7 BC014242 XM_938936 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR190002 ARi75A02 pGCAP10 NM_001048249.3  
GGGATCCGATCCCGTGGGGCTATGTAGGGGAAGTTGGTGGCTGCAGCTGCCGTGGTTTTC
HKR405579 RBdS013P19 pGCAP10 NM_001048249.3  
GTTCCGGTCTGGCGGTGAGTGGGGAGTGGGATCCGATCCCGTGGGGCTATGTAGGGGAAG
HKR433229 RBdS083B05 pGCAP10 NM_001048249.3  
GGTAGGGGAAGTTGGTGGCTGCAGCTGCCGTGGTTTTCTCCTGGTGTCCAGCAGAAACGG
HKR442120 RBdS105E24 pGCAP10 NM_001048249.3  
CGGCCGGCCGATGGGGGAGTGGGATCCGATCCCGTGGGGCTATGTAGGGGAAGTTGGTGG
HKR462648 RBdS156K08 pGCAP10 NM_001048249.3  
GCTTCCTGCTTCCGGTCTGGCGGTGAGTGGGGAGTGGGATCCGATCCCGTGGGGCTATGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl