Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06932

HP ID(1) HP06932
Gene ID(2) 23637
Gene Symbol finder RABGAP1
Protein Name RAB GTPase activating protein 1
RefSeq NM_012197.3
Length of RefSeq (bp) 4999
Chromosome 9q33.2
Reference DDBJ accession
UniGene Hs.271341

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS008C21 pGCAP10 GAGGCGGCGGAGCCNCCGGGACGGCGAGCGGCGGGCGGCGGAGGAGGAGACGGCAGGCAT
RBd07B06 pGCAP10 GGCGGAACAGCCCGCTCTCACCCATNAAAAATATTTAATCATTCATGTGTTGAGACNCNT
RBdS007L05 pGCAP10 GGGGGACAGGGCGGTTTGGGAGGCCCAGGCGGCGGAGCCTCCGGGACGGCGAGCGGCGGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl