Prev. |  KEGG KO K20284 > 

RIKEN DNA Bank Human Resource - RABGAP1

Gene ID NCBI Gene 23637 |  KEGG hsa:23637
Gene Symbol RABGAP1
Protein Name RAB GTPase activating protein 1
Synonyms GAPCENA|TBC1D11
Ortholog resource in our bank

  RABGAP1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Individualy Deposited Resource

Catalog number Name of Resource Description
RDB14997 pEGFP-C1-human TBC1D11 Expression vector of human TBC1 domain family member 11 (TBC1D11), fused with N-terminal EGFP, CMV promoter.

webcatalog20220516.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX039369 IRAK098H01 pCMV-SPORT6 BC054492 NM_012197 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2022Apr03.csv
GNP_full_IRAL_2022Apr03.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR203269 ARiS008C21 pGCAP10 NM_012197.3  
GAGGCGGCGGAGCCNCCGGGACGGCGAGCGGCGGGCGGCGGAGGAGGAGACGGCAGGCAT
HKR362830 RBd07B06 pGCAP10 NM_012197.3  
GGCGGAACAGCCCGCTCTCACCCATNAAAAATATTTAATCATTCATGTGTTGAGACNCNT
HKR403069 RBdS007L05 pGCAP10 NM_012197.3  
GGGGGACAGGGCGGTTTGGGAGGCCCAGGCGGCGGAGCCTCCGGGACGGCGAGCGGCGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv

2023.04.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl