Prev. | NRCD Clone W | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06917

HP ID(1) HP06917
Gene ID(2) 7465
Gene Symbol finder WEE1
Protein Name WEE1 homolog (S. pombe)
RefSeq NM_003390.2
Length of RefSeq (bp) 4232
Chromosome 11p15.3-p15.1
Reference DDBJ accession
UniGene Hs.249441

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi11D03 pGCAP10 GGGTGCTCGGGCCGCCCCGCCTCTGCCGGAAAGTCCGCGCCGCCGCTGCCGCCACCGTCC
RBdS132N03 pGCAP10 TGGCCGGAAAGTCCGCGCCGCCGCTGCCGCCACCGTCCGCAGCCCGAGCGCCCCGGAGCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl