Prev. |  KEGG KO K06632 > 

RIKEN DNA Bank Human Resource - WEE1

Gene ID NCBI Gene 7465 |  KEGG hsa:7465
Gene Symbol WEE1
Protein Name WEE1 G2 checkpoint kinase
Synonyms WEE1A|WEE1hu
Featured content Rb pathway
Ortholog resource in our bank

  WEE1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB01204 WEE1Hu Human wee1+ -like kinase cDNA
RDB02277 pAxCAhWEE1 (forward) Shuttle vector to produce rAd expressing human WEE1
RDB02278 pAxCAhWEE1 (reverse) Shuttle vector to produce rAd expressing human WEE1
RDB02669 pAxCALNLhWEE1 (forward) Shuttle vector to produce rAd expressing human WEE1
RDB02670 pAxCALNLhWEE1 (reverse) Shuttle vector to produce rAd expressing human WEE1
RDB02736 AxCAhWEE1 (forward) Recombinant adenovirus harboring human WEE1 cDNA
RDB02787 AxCALNLhWEE1 (forward) Recombinant adenovirus harboring human WEE1Hu (WEE1 homologue) cDNA

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX044246 IRAK110K06 pCMV-SPORT6 BC051831 NM_003390 Full/var
HGY067421 IRAK168J05 pBluescriptR BC070052 NM_003390 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE043434 W01A108J18 pENTR-TOPO IRAK168J05 BC070052 NM_003390  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR164475 ARi11D03 pGCAP10 NM_003390.2  
GGGTGCTCGGGCCGCCCCGCCTCTGCCGGAAAGTCCGCGCCGCCGCTGCCGCCACCGTCC
HKR453115 RBdS132N03 pGCAP10 NM_003390.2  
TGGCCGGAAAGTCCGCGCCGCCGCTGCCGCCACCGTCCGCAGCCCGAGCGCCCCGGAGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl