Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS132N03

Clone ID RBdS132N03
HP ID HP06917
Gene ID 7465
Gene Symbol WEE1
Protein Name WEE1 homolog (S. pombe)
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_003390.2
Length of RefSeq (bp) 4232
Chromosome 11p15.3-p15.1
Reference DDBJ accession
UniGene Hs.249441
5'-terminal sequence TGGCCGGAAAGTCCGCGCCGCCGCTGCCGCCACCGTCCGCAGCCCGAGCGCCCCGGAGCC
2011.08.28