Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06850

HP ID(1) HP06850
Gene ID(2) 51300
Gene Symbol finder C3orf1
Protein Name chromosome 3 open reading frame 1
RefSeq NM_016589.3
Length of RefSeq (bp) 1596
Chromosome 3q13.33
Reference DDBJ accession
UniGene Hs.477287

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS118J05 pGCAP10 GGGGACTTCCTGTGTCGTATTTCCAAGGACTCCAAAGCGAGGCCGGGGACTGAAGTGAAC
RBd04G08 pGCAP10 TGGACTCCAAAGCGAGGCCGGGGACTGAAGGTGTGGGTGTCGAGCCCTCTGGCAGAGGGT
RBdS051L19 pGCAP10 GAGAGGGTTAACCTGGGTCAAATGCACGGATTCTCACCTCGTACAGTTACGCTCTCCCGC
RBdS081A14 pGCAP10 GGTGTCGTATTTCCAAGGACTCCAAAGCGAGGCCGGGGACTGAAGGTGTGGGTGTCGAGC
RBdS081A15 pGCAP10 GCCNCANNTNNACGCCANTGAAATCCGNGTGNGNNNCGTNNGTACAGGGTTTCCANCNNG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl