Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS051L19

Clone ID RBdS051L19
HP ID HP06850
Gene ID 51300
Gene Symbol C3orf1
Protein Name chromosome 3 open reading frame 1
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_016589.3
Length of RefSeq (bp) 1596
Chromosome 3q13.33
Reference DDBJ accession
UniGene Hs.477287
5'-terminal sequence GAGAGGGTTAACCTGGGTCAAATGCACGGATTCTCACCTCGTACAGTTACGCTCTCCCGC
2011.08.28