Prev. | 

RIKEN DNA Bank Human Resource - TIMMDC1

Gene ID NCBI Gene 51300 |  KEGG hsa:51300
Gene Symbol TIMMDC1
Protein Name translocase of inner mitochondrial membrane domain containing 1
Synonyms C3orf1
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY091793 IRAL029I01 pOTB7 BC012341 NM_016589 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR247421 ARiS118J05 pGCAP10 NM_016589.3  
GGGGACTTCCTGTGTCGTATTTCCAAGGACTCCAAAGCGAGGCCGGGGACTGAAGTGAAC
HKR361752 RBd04G08 pGCAP10 NM_016589.3  
TGGACTCCAAAGCGAGGCCGGGGACTGAAGGTGTGGGTGTCGAGCCCTCTGGCAGAGGGT
HKR420683 RBdS051L19 pGCAP10 NM_016589.3  
GAGAGGGTTAACCTGGGTCAAATGCACGGATTCTCACCTCGTACAGTTACGCTCTCCCGC
HKR432414 RBdS081A14 pGCAP10 NM_016589.3  
GGTGTCGTATTTCCAAGGACTCCAAAGCGAGGCCGGGGACTGAAGGTGTGGGTGTCGAGC
HKR432415 RBdS081A15 pGCAP10 NM_016589.3  
GCCNCANNTNNACGCCANTGAAATCCGNGTGNGNNNCGTNNGTACAGGGTTTCCANCNNG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl