Prev. | NRCD Clone K | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06839

HP ID(1) HP06839
Gene ID(2) 23028
Gene Symbol finder KDM1
Protein Name lysine (K)-specific demethylase 1
RefSeq NM_015013.3
Length of RefSeq (bp) 3053
Chromosome 1p36.12
Reference DDBJ accession
UniGene Hs.591518

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd03H03 pGCAP10 GAGCGTGAAGCGAGGCGAGGCAAGGCTTTTCGGACCCACGGAGCGACAGAGCGAGCGGCC
RBd35H04 pGCAP10 GGAGGCAAGGCTTTTCGGACCCACGGAGCGACAGAGCGAGCGGCCCCTACGGCCGTCGGC
RBd87F05 pGCAP10 GGCGCGGGCAGCGTGAAGCGAGGCGAGGCAAGGCTTTTCGGACCCACGGAGCGACAGAGC
RBdS014F05 pGCAP10 GGAGGCAAGGCTTTTCGGACCCACGGAGCGACAGAGCGAGCGGCCCCTACGGCCGTCGGC
RBdS083A23 pGCAP10 GGCGCGGGCAGCGTGAAGCGAGGCGAGGCAAGGCTTTTCGGACCCACGGAGCGACAGAGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl