Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS083A23

Clone ID RBdS083A23
HP ID HP06839
Gene ID 23028
Gene Symbol KDM1
Protein Name lysine (K)-specific demethylase 1
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_015013.3
Length of RefSeq (bp) 3053
Chromosome 1p36.12
Reference DDBJ accession
UniGene Hs.591518
5'-terminal sequence GGCGCGGGCAGCGTGAAGCGAGGCGAGGCAAGGCTTTTCGGACCCACGGAGCGACAGAGC
2011.08.28