Prev. | Human A to Z list > K > 

RIKEN DNA Bank Human Resource - KDM1A

Gene ID (NCBI) 23028
Gene Symbol KDM1A
Protein Name lysine (K)-specific demethylase 1A
Synonyms AOF2|BHC110|KDM1|LSD1
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX010403 IRAK026A03 pCMV-SPORT6 BC016639 NM_015013 Partial/var
HGY028340 IRAK070O04 pBluescriptR BC040194 NM_015013 Full/var
HGY042779 IRAK106P19 pBluescript BC048134 NM_015013 Full/var
HGY097068 IRAL042L04 pOTB7 BC025362 NM_015013 Partial

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA
Clone ID Sequence (DDBJ)
HGE091206 M01C028A06 pDONR221 MGC03-F03 BC048134 NM_015013
HGE091254 M01C028C06 pDONR221 MGC03-F03 BC048134 NM_015013
HGE091302 M01C028E06 pDONR221 MGC03-F03 BC048134 NM_015013
HGE091350 M01C028G06 pDONR221 MGC03-F03 BC048134 NM_015013
HGE091398 M01C028I06 pDONR221 MGC03-F03 BC048134 NM_015013
HGE091446 M01C028K06 pDONR221 MGC03-F03 BC048134 NM_015013
HGE091494 M01C028M06 pDONR221 MGC03-F03 BC048134 NM_015013
HGE091542 M01C028O06 pDONR221 MGC03-F03 BC048134 NM_015013

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR361371 RBd03H03 pGCAP10 NM_015013.3
GAGCGTGAAGCGAGGCGAGGCAAGGCTTTTCGGACCCACGGAGCGACAGAGCGAGCGGCC
HKR374172 RBd35H04 pGCAP10 NM_015013.3
GGAGGCAAGGCTTTTCGGACCCACGGAGCGACAGAGCGAGCGGCCCCTACGGCCGTCGGC
HKR394925 RBd87F05 pGCAP10 NM_015013.3
GGCGCGGGCAGCGTGAAGCGAGGCGAGGCAAGGCTTTTCGGACCCACGGAGCGACAGAGC
HKR405725 RBdS014F05 pGCAP10 NM_015013.3
GGAGGCAAGGCTTTTCGGACCCACGGAGCGACAGAGCGAGCGGCCCCTACGGCCGTCGGC
HKR433223 RBdS083A23 pGCAP10 NM_015013.3
GGCGCGGGCAGCGTGAAGCGAGGCGAGGCAAGGCTTTTCGGACCCACGGAGCGACAGAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.05

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl