Prev. | NRCD Clone X | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06830

HP ID(1) HP06830
Gene ID(2) 57510
Gene Symbol finder XPO5
Protein Name exportin 5
RefSeq NM_020750.1
Length of RefSeq (bp) 2987
Chromosome 6p21.1
Reference DDBJ accession
UniGene Hs.203206

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd03A04 pGCAP10 GACCAACGGGTGGTCTCGCCGAGGGAGCTGTCGTGCCTCGTGGTCCCGGGACTGCAGTGG
RBd48F11 pGCAP10 GGCTGCTAACGCTCCTCCTCCAGCTTCCCACCCCCGCCGCCCGCCGCGGCCCGGTACCAA
RBdS132H07 pGCAP10 GAGTGGCGGGCCGGGCGCGTGCGCAGCGCCGGCTTCTTCCCAGCGCGAGTTGCTGCTAAC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl