Prev. |  KEGG KO K14289 > 

RIKEN DNA Bank Human Resource - XPO5

Gene ID NCBI Gene 57510 |  KEGG hsa:57510
Gene Symbol XPO5
Protein Name exportin 5
Synonyms exp5
Ortholog resource in our bank

  XPO5

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY089369 IRAL023H01 pOTB7 BC008347 NM_020750 Partial
HGY090761 IRAL026P01 pOTB7 BC009969 NM_020750 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2022Apr03.csv
GNP_full_IRAL_2022Apr03.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR361204 RBd03A04 pGCAP10 NM_020750.1  
GACCAACGGGTGGTCTCGCCGAGGGAGCTGTCGTGCCTCGTGGTCCCGGGACTGCAGTGG
HKR379331 RBd48F11 pGCAP10 NM_020750.1  
GGCTGCTAACGCTCCTCCTCCAGCTTCCCACCCCCGCCGCCCGCCGCGGCCCGGTACCAA
HKR452975 RBdS132H07 pGCAP10 NM_020750.1  
GAGTGGCGGGCCGGGCGCGTGCGCAGCGCCGGCTTCTTCCCAGCGCGAGTTGCTGCTAAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.09.29

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl