Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06748

HP ID(1) HP06748
Gene ID(2) 57665
Gene Symbol finder RDH14
Protein Name retinol dehydrogenase 14 (all-trans/9-cis/11-cis)
RefSeq NM_020905.3
Length of RefSeq (bp) 1602
Chromosome 2p24.2
Reference DDBJ accession
UniGene Hs.288880

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe98H10 pKA1U5 GACTGCGGCGGCAGTACTGGCCGCTCTGGGCGGGGCGCTGTGGCTGGCGGCCCGCCGGTT
ARi25D10 pGCAP10 TGGCGCCCCAGCGTTCTCCGCGTACAGGTGGTCTCTTGGGTTCCGGTAAGGCGGCGGCTG
RBdS154O23 pGCAP10 GAGCATGCCCCACGCGCACCGTCAGGGGCCGACCCGCCGCGCCCCAGCGTTCTCCGCGTA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl