Prev. |  KEGG KO K11162 > 

RIKEN DNA Bank Human Resource - RDH14

Gene ID NCBI Gene 57665 |  KEGG hsa:57665
Gene Symbol RDH14
Protein Name retinol dehydrogenase 14
Synonyms PAN2|SDR7C4
Ortholog resource in our bank

  RDH14

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY090348 IRAL025O12 pOTB7 BC009830 NM_020905 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR079378 ARe98H10 pKA1U5 NM_020905.3  
GACTGCGGCGGCAGTACTGGCCGCTCTGGGCGGGGCGCTGTGGCTGGCGGCCCGCCGGTT
HKR170082 ARi25D10 pGCAP10 NM_020905.3  
TGGCGCCCCAGCGTTCTCCGCGTACAGGTGGTCTCTTGGGTTCCGGTAAGGCGGCGGCTG
HKR461959 RBdS154O23 pGCAP10 NM_020905.3  
GAGCATGCCCCACGCGCACCGTCAGGGGCCGACCCGCCGCGCCCCAGCGTTCTCCGCGTA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl