Prev. | NRCD Clone G | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06683

HP ID(1) HP06683
Gene ID(2) 2784
Gene Symbol finder GNB3
Protein Name guanine nucleotide binding protein (G protein), beta polypeptide 3
RefSeq NM_002075.2
Length of RefSeq (bp) 1923
Chromosome 12p13.31
Reference DDBJ accession
UniGene Hs.631657

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb29B08 pGCAP1 AB593098 AAATGTGTGAGAGCCTGGGCAGGTGACGGGCGGGCGCGGGCGTCGCAGCTGAGGGAGTAA
RBb32A12 pGCAP1 AB593099 GAGGTGACGGGCGGGCGCGGGCGTCGCAGCTGAGGGAGTAAGGAGGCTCCCAGGAACCGG
RBb32C06 pGCAP1 AB593099 GGAGCCTGGGCAGGTGACGGGCGGGCGCGGGCGTCGCAGCTGAGGGAGTAAGGAGGCTCC
RBd10D08 pGCAP10 GGAGTAAGGAGGCTCCCAGGAACCGGAGCTGGAAACCCGGCCGAGGTCCAGCCAGAGCCC
RBd21C02 pGCAP10 GAGAGCCTGGGCAGGTGACGGGCGGGCGCGGGCGTCGCAGCTGAGGGAGTAAGGAGGCTC
RBd21G02 pGCAP10 TAGCTCCTCTGGCAGCAGAGCCTGGGCAGGTGACGGGCGGGCGCGGGCGTCGCAGCTGAG
RBd22A10 pGCAP10 GGGGCCAGGCCAGGCCAGGCCAGCTCCTCTGGCAGCAGAGCCTGNGCAGGTGACGGGCGG
RBd26D03 pGCAP10 GAGAGCCTGGGCAGGTGACGGGCGGGCGCGGGCGTCGCAGCTGAGGGAGTAAGGAGGCTC
RBd36G08 pGCAP10 GCTGGGCAGGTGACGGGCGGGCGCGGGCGTCGCAGCTGAGGGAGTAAGGAGGCTCCCAGG
RBd37F01 pGCAP10 GAGCAGAGCCTGGGCAGGTGACGGGCGGGCGCGGGCGTCGCAGCTGAGGGAGTAAGGAGG
RBd82D06 pGCAP10 AGCTCCTCTGGCAGCAGAGCCTGGGCAGGTGACGGGCGGGCGCGGGCGTCGCAGCTGAGG
RBd89G06 pGCAP10 AGAGGTGACGGGCGGGCGCGGGCGTCGCAGCTGAGGGAGTAAGGAGGCTCCCAGGAACCG
RBd93A06 pGCAP10 GAGAGCCTGGGCAGGTGACGGGCGGGCGCGGGCGTCGCAGCTGAGGGAGTAAGGAGGCTC
RBd94A06 pGCAP10 GGCAGCAGAGCCTGGGCAGGTGACGGGCGGGCGCGGGCGTCGCAGCTGAGGGAGTAAGGA
RBdS013C03 pGCAP10 GTGGCAGCAGAGCCTGGGCAGGTGACGGGCGGGCGCGGGCGTCGCAGCTGAGGGAGTAAG
RBdS015D09 pGCAP10 AGCTCCTCTGGCAGCAGAGCCTGGGCAGGTGACGGGCGGGCGCGGGCGTCGCAGCTGAGG
RBdS051B03 pGCAP10 GAGCAGAGCCTGGGCAGGTGACGGGCGGGCGCGGGCGTCGCAGCTGAGGGAGTAAGGAGG
RBdS070O09 pGCAP10 GAGCNGANCCTGGGCAGGTGACGGGCGGGCGCGGGCGTCGCAGCTGAGGGAGTAAGGAGG
RBdS081L24 pGCAP10 GAGAGCCTGGGCAGGTGACGGGCGGGCGCGGGCGTCGCAGCTGAGGGAGTAAGGAGGCTC
RBdS081N19 pGCAP10 GAGGCCAGGCCAGCTCCTCTGGCAGCAGAGCCTGGGCAGGTGACGGGCGGGCGCGGGCGT
RBdS083A20 pGCAP10 GAGAGCCTGGGCAGGTGACGGGCGGGCGCGGGCGTCGCAGCTGAGGGAGTAAGGAGGCTC
RBdS083C22 pGCAP10 GAGCAGAGCCTGGGCAGGTGACGGGCGGGCGCGGGCGTCGCAGCTGAGGGAGTAAGGAGG
RBdS104L11 pGCAP10 TGAGGCCAGGCCAGCTCCTCTGGCAGCAGAGCCTGGGCAGGTGACGGGCGGGCGCGGGCG
RBdS132H03 pGCAP10 CGGCCGGCCGATGGACGGGCGGGCGCGGGCGTCGCAGCTGAGGGAGTAAGGAGGCTCCCA
RBdS156M09 pGCAP10 GCAGCTCCTCTGGCAGCAGAGCCTGGGCAGGTGACGGGCGGGCGCGGGCGTCGCAGCTGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl