Prev. |  Human A to Z list >  G >  GNB3 > 

RBb32C06 - NRCD Human cDNA Clone

Catalog Number HKR332854
Clone Name RBb32C06
Clone info. Plasmid clone of human GNB3 cDNA with SV40 promoter
Vector(1) pGCAP1
5'-terminal sequence(2) GGAGCCTGGGCAGGTGACGGGCGGGCGCGGGCGTCGCAGCTGAGGGAGTAAGGAGGCTCC
Sequence, submitted(3) AB593099 [link]
Note Full cds when compared using AB593099
 
Sequence, refered NM_002075.4 (NCBI RefSeq mRNA)
Gene Symbol and ID(4) GNB3 (NCBI Gene 2784)  other clone of GNB3 in our bank
Synonyms CSNB1H|HG2D
Protein Name G protein subunit beta 3
Links

  KEGG

  NCBI Gene

  NCBI RefSeq

(1) Please refer below or Vector Backbone at NRCD Human cDNA Clone HP.
pKA1U5 (accession no. AB191256 (map of pKA1U5)
pGCAP1 (accession no. AB191257 (map of pGCAP1)
pGCAP10 (accession no. AB371573 (map of pGCAP10)
(2) 5' terminal sequence of insert provided by the depositor.
(3) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(4) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Plasmid request [in Japanese] [in English]

Catalog # Clone name Shipping form Fee (non-profit org.)
HKR332854 RBb32C06 DNA solution

How to cite this biological resource

Materials & Methods section:

The RBb32C06 was provided by the RIKEN BRC through the National BioResource Project of the MEXT, Japan (cat. HKR332854).

Sequence information

Restriction map is not available.

Gene Engineering Division will sequence a portion of this resource and digest with restriction emzyme for verification before shipping.

References and tips

Featured content

Reference


2023.07.07

NRCDhumcloneList_RB_2023May03.csv - GNP_filter3_NRCD_html_230707.pl