Prev. |  KEGG KO K07825 > 

RIKEN DNA Bank Human Resource - GNB3

Gene ID NCBI Gene 2784 |  KEGG hsa:2784
Gene Symbol GNB3
Protein Name G protein subunit beta 3
Synonyms CSNB1H
Ortholog resources KEGG ortholog (KEGG orthology K07825) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY082121 IRAL005F01 pOTB7 BC002454 NM_002075 Full/var
HGY082459 IRAL006C11 pOTB7 BC000115 NM_002075 Full/var
HGY091929 IRAL029N17 pOTB7 BC015920 NM_002075 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR331632 RBb29B08 pGCAP1 NM_002075.2  
AAATGTGTGAGAGCCTGGGCAGGTGACGGGCGGGCGCGGGCGTCGCAGCTGAGGGAGTAA
HKR332812 RBb32A12 pGCAP1 NM_002075.2  
GAGGTGACGGGCGGGCGCGGGCGTCGCAGCTGAGGGAGTAAGGAGGCTCCCAGGAACCGG
HKR332854 RBb32C06 pGCAP1 NM_002075.2  
GGAGCCTGGGCAGGTGACGGGCGGGCGCGGGCGTCGCAGCTGAGGGAGTAAGGAGGCTCC
HKR364080 RBd10D08 pGCAP10 NM_002075.2  
GGAGTAAGGAGGCTCCCAGGAACCGGAGCTGGAAACCCGGCCGAGGTCCAGCCAGAGCCC
HKR368450 RBd21C02 pGCAP10 NM_002075.2  
GAGAGCCTGGGCAGGTGACGGGCGGGCGCGGGCGTCGCAGCTGAGGGAGTAAGGAGGCTC
HKR368546 RBd21G02 pGCAP10 NM_002075.2  
TAGCTCCTCTGGCAGCAGAGCCTGGGCAGGTGACGGGCGGGCGCGGGCGTCGCAGCTGAG
HKR368810 RBd22A10 pGCAP10 NM_002075.2  
GGGGCCAGGCCAGGCCAGGCCAGCTCCTCTGGCAGCAGAGCCTGNGCAGGTGACGGGCGG
HKR370475 RBd26D03 pGCAP10 NM_002075.2  
GAGAGCCTGGGCAGGTGACGGGCGGGCGCGGGCGTCGCAGCTGAGGGAGTAAGGAGGCTC
HKR374552 RBd36G08 pGCAP10 NM_002075.2  
GCTGGGCAGGTGACGGGCGGGCGCGGGCGTCGCAGCTGAGGGAGTAAGGAGGCTCCCAGG
HKR374921 RBd37F01 pGCAP10 NM_002075.2  
GAGCAGAGCCTGGGCAGGTGACGGGCGGGCGCGGGCGTCGCAGCTGAGGGAGTAAGGAGG
HKR392878 RBd82D06 pGCAP10 NM_002075.2  
AGCTCCTCTGGCAGCAGAGCCTGGGCAGGTGACGGGCGGGCGCGGGCGTCGCAGCTGAGG
HKR395750 RBd89G06 pGCAP10 NM_002075.2  
AGAGGTGACGGGCGGGCGCGGGCGTCGCAGCTGAGGGAGTAAGGAGGCTCCCAGGAACCG
HKR397206 RBd93A06 pGCAP10 NM_002075.2  
GAGAGCCTGGGCAGGTGACGGGCGGGCGCGGGCGTCGCAGCTGAGGGAGTAAGGAGGCTC
HKR397606 RBd94A06 pGCAP10 NM_002075.2  
GGCAGCAGAGCCTGGGCAGGTGACGGGCGGGCGCGGGCGTCGCAGCTGAGGGAGTAAGGA
HKR405251 RBdS013C03 pGCAP10 NM_002075.2  
GTGGCAGCAGAGCCTGGGCAGGTGACGGGCGGGCGCGGGCGTCGCAGCTGAGGGAGTAAG
HKR406081 RBdS015D09 pGCAP10 NM_002075.2  
AGCTCCTCTGGCAGCAGAGCCTGGGCAGGTGACGGGCGGGCGCGGGCGTCGCAGCTGAGG
HKR420427 RBdS051B03 pGCAP10 NM_002075.2  
GAGCAGAGCCTGGGCAGGTGACGGGCGGGCGCGGGCGTCGCAGCTGAGGGAGTAAGGAGG
HKR428345 RBdS070O09 pGCAP10 NM_002075.2  
GAGCNGANCCTGGGCAGGTGACGGGCGGGCGCGGGCGTCGCAGCTGAGGGAGTAAGGAGG
HKR432688 RBdS081L24 pGCAP10 NM_002075.2  
GAGAGCCTGGGCAGGTGACGGGCGGGCGCGGGCGTCGCAGCTGAGGGAGTAAGGAGGCTC
HKR432731 RBdS081N19 pGCAP10 NM_002075.2  
GAGGCCAGGCCAGCTCCTCTGGCAGCAGAGCCTGGGCAGGTGACGGGCGGGCGCGGGCGT
HKR433220 RBdS083A20 pGCAP10 NM_002075.2  
GAGAGCCTGGGCAGGTGACGGGCGGGCGCGGGCGTCGCAGCTGAGGGAGTAAGGAGGCTC
HKR433270 RBdS083C22 pGCAP10 NM_002075.2  
GAGCAGAGCCTGGGCAGGTGACGGGCGGGCGCGGGCGTCGCAGCTGAGGGAGTAAGGAGG
HKR441875 RBdS104L11 pGCAP10 NM_002075.2  
TGAGGCCAGGCCAGCTCCTCTGGCAGCAGAGCCTGGGCAGGTGACGGGCGGGCGCGGGCG
HKR452971 RBdS132H03 pGCAP10 NM_002075.2  
CGGCCGGCCGATGGACGGGCGGGCGCGGGCGTCGCAGCTGAGGGAGTAAGGAGGCTCCCA
HKR462697 RBdS156M09 pGCAP10 NM_002075.2  
GCAGCTCCTCTGGCAGCAGAGCCTGGGCAGGTGACGGGCGGGCGCGGGCGTCGCAGCTGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl