Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06677

HP ID(1) HP06677
Gene ID(2) 125950
Gene Symbol finder RAVER1
Protein Name ribonucleoprotein, PTB-binding 1
RefSeq NM_133452.2
Length of RefSeq (bp) 3606
Chromosome 19p13.2
Reference DDBJ accession
UniGene Hs.714339

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS096B11 pGCAP10 GNTGGTGCGNCCCTTCTGCAGCCTGGANCNCTGCTTCCTGGTCTACAGTGAGCGCACTGG
RBb72H02 pGCAP1 AAATGTGGGGGCGACACCAACGCTGAGGAAGTACATGACCTGCTCAGTGACTATGAGCTC
RBd40H10 pGCAP10 GAAGGCGCCGGGTTTCCCAAGATGGCGGCGGACGTGTCTGTTACTCACCGGCCCCCGCTG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl