Prev. | 

RIKEN DNA Bank Human Resource - RAVER1

Gene ID NCBI Gene 125950 |  KEGG hsa:125950
Gene Symbol RAVER1
Protein Name ribonucleoprotein, PTB binding 1
Synonyms -
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX025686 IRAK064D14 pCMV-SPORT6 BC037565 NM_133452 Partial/var
HGX031578 IRAK078P18 pCMV-SPORT6 BC037428 NM_133452 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE080822 M01C002A22 pDONR221 04-134-2_1-F11 BC037428 NM_133452  
HGE080870 M01C002C22 pDONR221 04-134-2_1-F11 BC037428 NM_133452  
HGE080918 M01C002E22 pDONR221 04-134-2_1-F11 BC037428 NM_133452  
HGE080966 M01C002G22 pDONR221 04-134-2_1-F11 BC037428 NM_133452  
HGE081014 M01C002I22 pDONR221 04-134-2_1-F11 BC037428 NM_133452  
HGE081062 M01C002K22 pDONR221 04-134-2_1-F11 BC037428 NM_133452  
HGE081110 M01C002M22 pDONR221 04-134-2_1-F11 BC037428 NM_133452  
HGE081158 M01C002O22 pDONR221 04-134-2_1-F11 BC037428 NM_133452  
HGE094044 M01C035B20 pDONR221 MGC07-D10 BC037428 NM_133452  
HGE094092 M01C035D20 pDONR221 MGC07-D10 BC037428 NM_133452  
HGE094140 M01C035F20 pDONR221 MGC07-D10 BC037428 NM_133452  
HGE094188 M01C035H20 pDONR221 MGC07-D10 BC037428 NM_133452  
HGE094236 M01C035J20 pDONR221 MGC07-D10 BC037428 NM_133452  
HGE094284 M01C035L20 pDONR221 MGC07-D10 BC037428 NM_133452  
HGE094332 M01C035N20 pDONR221 MGC07-D10 BC037428 NM_133452  
HGE094380 M01C035P20 pDONR221 MGC07-D10 BC037428 NM_133452  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR238435 ARiS096B11 pGCAP10 NM_133452.2  
GNTGGTGCGNCCCTTCTGCAGCCTGGANCNCTGCTTCCTGGTCTACAGTGAGCGCACTGG
HKR348970 RBb72H02 pGCAP1 NM_133452.2  
AAATGTGGGGGCGACACCAACGCTGAGGAAGTACATGACCTGCTCAGTGACTATGAGCTC
HKR376178 RBd40H10 pGCAP10 NM_133452.2  
GAAGGCGCCGGGTTTCCCAAGATGGCGGCGGACGTGTCTGTTACTCACCGGCCCCCGCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl