Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06619

HP ID(1) HP06619
Gene ID(2) 5970
Gene Symbol finder RELA
Protein Name v-rel reticuloendotheliosis viral oncogene homolog A (avian)
RefSeq NM_021975.3
Length of RefSeq (bp) 2595
Chromosome 11q13
Reference DDBJ accession
UniGene Hs.502875

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe91B03 pKA1U5 GATTCCGGGCAGTGACGCGACGGCGGGCCGCGCGGCGCATTTCCGCCTCTGGCGAATGGC
ARiS020G11 pGCAP10 CGGCCGGCCGATGGCCGCCTCTGGCGAATGGCTCGTCTGTAGTGCACGCCGCGGGCCCAG
ARiS045H12 pGCAP10 GCCGCCTCTGGCGAATGGCTCGTCTGTAGTGCACGCCGCGGGCCCAGCTGCGACCCCGGC
RBdS104G04 pGCAP10

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl