Prev. | Human A to Z list > R > 

RIKEN DNA Bank Human Resource - RELA

Gene ID (NCBI) 5970
Gene Symbol RELA
Protein Name RELA proto-oncogene, NF-kB subunit
Synonyms NFKB3|p65
Databases KEGG hsa:5970 |  NCBI Gene 5970
Featured content Sphingolipid signaling pathway (human)
Featured content NF-kappa B signaling pathway (human)
Featured content T cell receptor signaling pathway (human)
Featured content B cell receptor signaling pathway (human)
Featured content HIF-1 signaling pathway - human
Featured content Apoptosis - human
Featured content Ortholog resources in the DNA Bank (KEGG orthology K04735)


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB04631 pAxCALNLhRELA(forward) Shuttle vector to generate rAd expressing human RELA
RDB04657 pAxCALNLhRELA(forward) Shuttle vector to generate rAd expressing human RELA
RDB04647 pAxCALNLhRELA(reverse) Shuttle vector to generate rAd expressing human RELA
RDB05318 pAxCALNLhRELA(forward) Shuttle vector to generate rAd expressing human RELA
RDB07366 pGL4-phRELA Promoter collection, Human RELA promoter

RDB_org_170226.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR076427 ARe91B03 pKA1U5 NM_021975.3  
GATTCCGGGCAGTGACGCGACGGCGGGCCGCGCGGCGCATTTCCGCCTCTGGCGAATGGC
HKR208155 ARiS020G11 pGCAP10 NM_021975.3  
CGGCCGGCCGATGGCCGCCTCTGGCGAATGGCTCGTCTGTAGTGCACGCCGCGGGCCCAG
HKR218180 ARiS045H12 pGCAP10 NM_021975.3  
GCCGCCTCTGGCGAATGGCTCGTCTGTAGTGCACGCCGCGGGCCCAGCTGCGACCCCGGC
HKR441748 RBdS104G04 pGCAP10 NM_021975.3  

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.06.07

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl