DNA Bank Top |  KEGG KO K04735 > 

RIKEN DNA Bank Human Resource - RELA

Gene ID NCBI Gene 5970 |  KEGG hsa:5970
Gene Symbol RELA
Protein Name RELA proto-oncogene, NF-kB subunit
Synonyms AIF3BL3|CMCU|NFKB3|p65
Featured content Sphingolipid signaling pathway (human)
Featured content NF-kappa B signaling pathway (human)
Featured content T cell receptor signaling pathway (human)
Featured content B cell receptor signaling pathway (human)
Featured content HIF-1 signaling pathway - human
Featured content Apoptosis - human
Featured content SARS-CoV-2 relevant human genes
Featured content Influenza A relevant genes - human
Featured content Mitophagy - human

Link

Ortholog resource in our bank

  RELA

External database

human RELA

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB07366 pGL4-phRELA Promoter collection, Human RELA promoter    
RDB05318 pAxCALNLhRELA(forward) Shuttle vector to generate rAd expressing human RELA    
RDB04657 pAxCALNLhRELA(forward) Shuttle vector to generate rAd expressing human RELA    
RDB04647 pAxCALNLhRELA(reverse) Shuttle vector to generate rAd expressing human RELA    
RDB04631 pAxCALNLhRELA(forward) Shuttle vector to generate rAd expressing human RELA    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR076427 ARe91B03 pKA1U5 NM_021975.3 done
GATTCCGGGCAGTGACGCGACGGCGGGCCGCGCGGCGCATTTCCGCCTCTGGCGAATGGC
HKR208155 ARiS020G11 pGCAP10 NM_021975.3  
CGGCCGGCCGATGGCCGCCTCTGGCGAATGGCTCGTCTGTAGTGCACGCCGCGGGCCCAG
HKR218180 ARiS045H12 pGCAP10 NM_021975.3  
GCCGCCTCTGGCGAATGGCTCGTCTGTAGTGCACGCCGCGGGCCCAGCTGCGACCCCGGC
HKR441748 RBdS104G04 pGCAP10 NM_021975.3  

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv

♦ No Approval Forms Required for Fluorescent Protein Genes Developed by Dr. Atsushi Miyawaki
♦ RIKEN BRC will be closed from December 28, 2024 through January 5, 2025 due to New Year's holidays.
♦ A bicistronic cell cycle reporter, Fucci2a (Sep 17, 2024)
♦ Monomeric Fluorescent Protein Resource, mStayGold (Dec 18, 2023)
♦ Visualization of Organelles update (Dec 18, 2023)
♦ Development of two mouse strains conditionally expressing bright luciferases (Sep 08, 2023)
♦ Autophagy and Mitophagy Updates (Aug 16, 2023)
♦ High intensity forms of luciferase and luminescent proteins from various organisms (BRC RESOURCE NEWS) (Apr 28, 2023)
♦ Plasmid of Cas9 expression/mRNA production, evaluation of the genome edit efficiency, and Knock-in donors and tags
♦ Fucci cell cycle indicator, Calcium sensor and Fluorescent and Luminescent protein resources
♦ Revision of Distribution Fees for Bioresources in RIKEN BRC
- - - - - - - - - - - - - - - - - - - -
♦ Mail News sign-up. Receive information of the forcusd resources, new available resources and more.
♦ Please visit "Terms of Use", "Quality control" and "Ordering instruction"
Dnaconda's recommendation BRC Resource News RIKEN BRC 20th RIKEN BRC News sign-up

2024.09.27

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl