RIKEN DNA Bank Human Resource

RIKEN DNA Bank Human Resource - RELA

Gene ID	NCBI Gene 5970 \| KEGG hsa:5970
Gene Symbol	RELA
Protein Name	RELA proto-oncogene, NF-kB subunit
Synonyms	CMCU\|NFKB3\|p65
Featured content	Sphingolipid signaling pathway (human)
Featured content	NF-kappa B signaling pathway (human)
Featured content	T cell receptor signaling pathway (human)
Featured content	B cell receptor signaling pathway (human)
Featured content	HIF-1 signaling pathway - human
Featured content	Apoptosis - human
Featured content	SARS-CoV-2 relevant human genes
Featured content	Influenza A relevant genes - human
Featured content	Mitophagy - human

Ortholog resource in our bank

  RELA

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Individualy Deposited Resource

Catalog number	Name of Resource	Description
RDB04631	pAxCALNLhRELA(forward)	Shuttle vector to generate rAd expressing human RELA
RDB04647	pAxCALNLhRELA(reverse)	Shuttle vector to generate rAd expressing human RELA
RDB04657	pAxCALNLhRELA(forward)	Shuttle vector to generate rAd expressing human RELA
RDB05318	pAxCALNLhRELA(forward)	Shuttle vector to generate rAd expressing human RELA
RDB07366	pGL4-phRELA	Promoter collection, Human RELA promoter

webcatalog20220516.tab

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	CDS comparison
	Clone name	Vector	Refered mRNA⁽¹⁾	CDS status
	5'-terminal sequence⁽²⁾
HKR076427	ARe91B03	pKA1U5	NM_021975.3
HKR076427	GATTCCGGGCAGTGACGCGACGGCGGGCCGCGCGGCGCATTTCCGCCTCTGGCGAATGGC
HKR208155	ARiS020G11	pGCAP10	NM_021975.3
HKR208155	CGGCCGGCCGATGGCCGCCTCTGGCGAATGGCTCGTCTGTAGTGCACGCCGCGGGCCCAG
HKR218180	ARiS045H12	pGCAP10	NM_021975.3
HKR218180	GCCGCCTCTGGCGAATGGCTCGTCTGTAGTGCACGCCGCGGGCCCAGCTGCGACCCCGGC
HKR441748	RBdS104G04	pGCAP10	NM_021975.3
HKR441748

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl