DNA Bank Top |  KEGG KO K04735 > 

RIKEN DNA Bank Human Resource - RELA

Gene ID NCBI Gene 5970 |  KEGG hsa:5970
Gene Symbol RELA
Protein Name RELA proto-oncogene, NF-kB subunit
Synonyms AIF3BL3|CMCU|NFKB3|p65
Featured content Sphingolipid signaling pathway (human)
Featured content NF-kappa B signaling pathway (human)
Featured content T cell receptor signaling pathway (human)
Featured content B cell receptor signaling pathway (human)
Featured content HIF-1 signaling pathway - human
Featured content Apoptosis - human
Featured content SARS-CoV-2 relevant human genes
Featured content Influenza A relevant genes - human
Featured content Mitophagy - human

Link

Ortholog resource in our bank

  RELA


External database

human RELA

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB07366 pGL4-phRELA Promoter collection, Human RELA promoter    
RDB05318 pAxCALNLhRELA(forward) Shuttle vector to generate rAd expressing human RELA    
RDB04657 pAxCALNLhRELA(forward) Shuttle vector to generate rAd expressing human RELA    
RDB04647 pAxCALNLhRELA(reverse) Shuttle vector to generate rAd expressing human RELA    
RDB04631 pAxCALNLhRELA(forward) Shuttle vector to generate rAd expressing human RELA    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR076427 ARe91B03 pKA1U5 NM_021975.3 done
GATTCCGGGCAGTGACGCGACGGCGGGCCGCGCGGCGCATTTCCGCCTCTGGCGAATGGC
HKR208155 ARiS020G11 pGCAP10 NM_021975.3  
CGGCCGGCCGATGGCCGCCTCTGGCGAATGGCTCGTCTGTAGTGCACGCCGCGGGCCCAG
HKR218180 ARiS045H12 pGCAP10 NM_021975.3  
GCCGCCTCTGGCGAATGGCTCGTCTGTAGTGCACGCCGCGGGCCCAGCTGCGACCCCGGC
HKR441748 RBdS104G04 pGCAP10 NM_021975.3  

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv


2024.09.27

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl