Prev. | NRCD Clone X | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06612

HP ID(1) HP06612
Gene ID(2) 23214
Gene Symbol finder XPO6
Protein Name exportin 6
RefSeq NM_015171.2
Length of RefSeq (bp) 4422
Chromosome 16p11.2
Reference DDBJ accession
UniGene Hs.460468

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe90D03 pKA1U5 GCgGCGCGTTGGGGCTGTTGGTCGGGGGCGGCCGCGCGGTACTAGCGGGCGGCTCCAGGG
ARi47F03 pGCAP10 TGAGCGGGCGGCTCCAGGGCGGGCGCGCGCAAGGATGCTCTAGGGGGCGGCGGCAGTGGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl