Prev. | 

RIKEN DNA Bank Human Resource - XPO6

Gene ID NCBI Gene 23214 |  KEGG hsa:23214
Gene Symbol XPO6
Protein Name exportin 6
Synonyms EXP6|RANBP20
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX066544 IRAK166F24 pCMV-SPORT6 BC078674 NM_015171 Partial/var
HGY085422 IRAL013J06 pOTB7 BC004403 NM_015171 Partial
HGY091380 IRAL028H12 pOTB7 BC014071 NM_015171 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR076075 ARe90D03 pKA1U5 NM_015171.2  
GCgGCGCGTTGGGGCTGTTGGTCGGGGGCGGCCGCGCGGTACTAGCGGGCGGCTCCAGGG
HKR178923 ARi47F03 pGCAP10 NM_015171.2  
TGAGCGGGCGGCTCCAGGGCGGGCGCGCGCAAGGATGCTCTAGGGGGCGGCGGCAGTGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl