Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06547

HP ID(1) HP06547
Gene ID(2) 11102
Gene Symbol finder RPP14
Protein Name ribonuclease P 14kDa subunit
RefSeq NM_007042.3
Length of RefSeq (bp) 3264
Chromosome 3p14.3
Reference DDBJ accession
UniGene Hs.446320

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe85A04 pKA1U5 GGTACGGCGCCGCGTAGGGTCTCGGCCGCAGAACGTGGCCGAGAGGCCCGGGCGAGACTT
RBb71B09 pGCAP1 GGCCTCTGTACGGCGCCGCGTAGGGTCTCGGCCGCAGAACGTGGCCGAGAGGCCCGGGCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl