Prev. |  KEGG KO K14529 > 

RIKEN DNA Bank Human Resource - RPP14

Gene ID NCBI Gene 11102 |  KEGG hsa:11102
Gene Symbol RPP14
Protein Name ribonuclease P/MRP subunit p14
Synonyms P14
Ortholog resource in our bank

  RPP14

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX011471 IRAK028L07 pCMV-SPORT6 BC012017 NM_007042 Full
HGY082260 IRAL005K20 pOTB7 BC002441 NM_007042 Full
HGY089797 IRAL024I05 pOTB7 BC007342 NM_007042 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR074004 ARe85A04 pKA1U5 NM_007042.3  
GGTACGGCGCCGCGTAGGGTCTCGGCCGCAGAACGTGGCCGAGAGGCCCGGGCGAGACTT
HKR348433 RBb71B09 pGCAP1 NM_007042.3  
GGCCTCTGTACGGCGCCGCGTAGGGTCTCGGCCGCAGAACGTGGCCGAGAGGCCCGGGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl