Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06545

HP ID(1) HP06545
Gene ID(2) 5899
Gene Symbol finder RALB
Protein Name v-ral simian leukemia viral oncogene homolog B (ras related; GTP binding protein)
RefSeq NM_002881.2
Length of RefSeq (bp) 2275
Chromosome 2cen-q13
Reference DDBJ accession
UniGene Hs.469820

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe80G09 pKA1U5 GCCCGGCTGCTCAATGACAAATCGGTGGAGGACGGCTGGGGTCCGGCCCCGGGAGGGGGC
ARi58B09 pGCAP10 GGCGGGCCGGGTGCGGACGGCGGAGGCGGCGGGACTGGTCCCTGCTCTTCAGTGGGTCAT
ARi58G10 pGCAP10 GGCGGGCCGGGTGCGGACGGCGGAGGCGGCGGGACTGGTCCCTGCTCTTCAGTGGGTCAT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl