Prev. |  KEGG KO K07835 > 

RIKEN DNA Bank Human Resource - RALB

Gene ID NCBI Gene 5899 |  KEGG hsa:5899
Gene Symbol RALB
Protein Name RAS like proto-oncogene B
Synonyms -
Ortholog resource in our bank

  RALB

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR072153 ARe80G09 pKA1U5 NM_002881.2  
GCCCGGCTGCTCAATGACAAATCGGTGGAGGACGGCTGGGGTCCGGCCCCGGGAGGGGGC
HKR183233 ARi58B09 pGCAP10 NM_002881.2  
GGCGGGCCGGGTGCGGACGGCGGAGGCGGCGGGACTGGTCCCTGCTCTTCAGTGGGTCAT
HKR183354 ARi58G10 pGCAP10 NM_002881.2 done
GGCGGGCCGGGTGCGGACGGCGGAGGCGGCGGGACTGGTCCCTGCTCTTCAGTGGGTCAT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.04.04

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl