Prev. | Human A to Z list > R > 

RIKEN DNA Bank Human Resource - RALB

Gene ID (NCBI) 5899
Gene Symbol RALB
Protein Name v-ral simian leukemia viral oncogene homolog B
Synonyms -
Databases KEGG link 01 |  NCBI Gene link 01


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR183233 ARi58B09 pGCAP10 NM_002881.2
GGCGGGCCGGGTGCGGACGGCGGAGGCGGCGGGACTGGTCCCTGCTCTTCAGTGGGTCAT
HKR183354 ARi58G10 pGCAP10 NM_002881.2
GGCGGGCCGGGTGCGGACGGCGGAGGCGGCGGGACTGGTCCCTGCTCTTCAGTGGGTCAT
HKR072153 ARe80G09 pKA1U5 NM_002881.2
GCCCGGCTGCTCAATGACAAATCGGTGGAGGACGGCTGGGGTCCGGCCCCGGGAGGGGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.02

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl