Prev. | NRCD Clone K | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06508

HP ID(1) HP06508
Gene ID(2) 57805
Gene Symbol finder KIAA1967
Protein Name KIAA1967
RefSeq NM_021174.4
Length of RefSeq (bp) 4031
Chromosome 8p22
Reference DDBJ accession
UniGene Hs.654720

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe79G10 pKA1U5 GAGAGGCGCTTCCGGTGGCGGCGGCAGCAGCGGCTGTGGTGGTTCCGGGTGTCTTTGTCC
RBd06E12 pGCAP10 GAGTCCTCCCTTGGTGGCCTCGCCGCGGCTCTGCTGGGAGACCCGGCGCTGGCGGCTGCT
RBdS110P08 pGCAP10 GGGTTCCGGGTGTCTTTGTCCCCCCGGTGTCGCTGCCCTGGCCCGCAGCCTTTTCCCCAC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl