Prev. | 

RIKEN DNA Bank Human Resource - CCAR2

Gene ID NCBI Gene 57805 |  KEGG hsa:57805
Gene Symbol CCAR2
Protein Name cell cycle and apoptosis regulator 2
Synonyms DBC-1|DBC1|KIAA1967|NET35|p30 DBC|p30DBC
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX054354 IRAK135O18 pCMV-SPORT6 BC065495 NM_199205 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR071754 ARe79G10 pKA1U5 NM_021174.4  
GAGAGGCGCTTCCGGTGGCGGCGGCAGCAGCGGCTGTGGTGGTTCCGGGTGTCTTTGTCC
HKR362508 RBd06E12 pGCAP10 NM_021174.4  
GAGTCCTCCCTTGGTGGCCTCGCCGCGGCTCTGCTGGGAGACCCGGCGCTGGCGGCTGCT
HKR444368 RBdS110P08 pGCAP10 NM_021174.4  
GGGTTCCGGGTGTCTTTGTCCCCCCGGTGTCGCTGCCCTGGCCCGCAGCCTTTTCCCCAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl