Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS110P08

Clone ID RBdS110P08
HP ID HP06508
Gene ID 57805
Gene Symbol KIAA1967
Protein Name KIAA1967
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_021174.4
Length of RefSeq (bp) 4031
Chromosome 8p22
Reference DDBJ accession
UniGene Hs.654720
5'-terminal sequence GGGTTCCGGGTGTCTTTGTCCCCCCGGTGTCGCTGCCCTGGCCCGCAGCCTTTTCCCCAC
2011.08.28